comRNA_72bf_250 ../smv_18seq.fa -P 0.5 -S 0.38 PARAMETERS: L = 4, Minimum length of a straight stem; E = -5.00 kcal/mol, Maximum stem energy allowed for a stem to be analyzed, in kcal/mol; S = 0.38, Minimum similarity score between two stems; P = 0.50, Minimum percentage of seqs in which common structure should occur; n = 10, Number of common structures to be reported; wa = 0.25, Weight factor for stem_position; wb = 0.25, Weight factor for stem_seq_identity; wc = 0.25, Weight factor for loop_seq_identity; wd = 0.125, Weight factor for stem_length; we = 0.125, Weight factor for stem_energy; m = 4, Maximum number of overlapping nt allowed between two stems; c = 0.30, Maximum percentage of overlap allowed between two stems; j = 0.70, Maximum percentage of overlap allowed between two different cliques; r = 0.40, Minimum percentage of similar stems for two cliques to be considered same when reporting structures; f = 10, Length of flanking nt of a stem to be refolded during structure refinement; v = 5, Maximum relaxation length of a loop from its original structure pattern; a = 1, Use anchor seqs; g = 0, Use topological sort to assemble stem blocks; Sequence file name: "../smv_18seq.fa" Sequences loaded ... 1 PKB183 27 nt 2 PKB184 31 nt 3 PKB185 24 nt 4 PKB186 29 nt 5 PKB187 27 nt 6 PKB188 23 nt 7 PKB189 28 nt 8 PKB194 28 nt 9 PKB195 31 nt 10 PKB196 24 nt 11 PKB197 29 nt 12 PKB198 32 nt 13 PKB199 23 nt 14 PKB200 28 nt 15 PKB201 29 nt 16 PKB202 34 nt 17 PKB203 24 nt 18 PKB204 29 nt Number of stems in each energy bin for each sequence: energy[kc/m] -10 -9 -8 -7 -6 -5 -4 -3 -2 -1 0 PKB183 1 0 0 0 0 0 0 0 0 0 0 0 PKB184 0 1 0 0 0 0 0 1 3 0 0 0 PKB185 1 0 0 0 0 0 1 0 0 0 0 0 PKB186 0 0 1 1 0 0 0 1 0 0 0 0 PKB187 0 0 1 0 0 0 1 0 0 0 0 0 PKB188 0 1 0 0 2 0 0 1 0 0 0 0 PKB189 1 0 0 1 1 0 0 0 1 0 0 0 PKB194 1 0 0 1 1 0 1 0 0 0 1 0 PKB195 0 0 1 1 0 0 1 0 1 0 0 0 PKB196 0 1 0 0 0 0 0 0 0 0 0 0 PKB197 0 0 0 1 1 0 0 1 0 0 0 0 PKB198 1 0 1 0 0 0 1 1 0 0 0 0 PKB199 0 0 1 1 0 0 1 0 0 0 0 0 PKB200 0 0 1 1 1 0 0 0 0 1 0 0 PKB201 1 0 0 0 1 0 1 0 0 1 0 0 PKB202 1 0 0 0 1 0 0 2 2 0 0 0 PKB203 0 0 1 0 0 0 0 0 0 0 0 0 PKB204 0 0 0 1 1 0 2 0 1 0 0 0 Pairwise Sequence Identity (%): 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 1 - 44 58 55 37 73 40 77 48 75 44 51 78 29 70 55 58 40 2 44 - 54 48 51 56 46 53 70 50 44 58 60 60 55 54 66 55 3 58 54 - 33 41 78 45 58 54 70 33 45 69 41 54 58 79 50 4 55 48 33 - 40 43 53 35 27 41 82 44 43 67 37 48 41 37 5 37 51 41 40 - 52 44 44 51 58 37 66 52 48 44 62 54 33 6 73 56 78 43 52 - 47 60 60 52 43 60 56 47 52 52 69 56 7 40 46 45 53 44 47 - 35 32 54 50 50 47 85 32 39 37 39 8 77 53 58 35 44 60 35 - 50 83 42 50 73 35 75 50 50 42 9 48 70 54 27 51 60 32 50 - 58 27 45 60 53 44 48 54 55 10 75 50 70 41 58 52 54 83 58 - 41 62 78 45 58 66 66 66 11 44 44 33 82 37 43 50 42 27 41 - 37 39 64 31 48 37 27 12 51 58 45 44 66 60 50 50 45 62 37 - 56 64 37 34 62 51 13 78 60 69 43 52 56 47 73 60 78 39 56 - 43 73 60 69 56 14 29 60 41 67 48 47 85 35 53 45 64 64 43 - 32 46 54 35 15 70 55 54 37 44 52 32 75 44 58 31 37 73 32 - 48 54 51 16 55 54 58 48 62 52 39 50 48 66 48 34 60 46 48 - 66 51 17 58 66 79 41 54 69 37 50 54 66 37 62 69 54 54 66 - 54 18 40 55 50 37 33 56 39 42 55 66 27 51 56 35 51 51 54 - Comparing stems pairwise ... Number of edges that has stem-similarity-score higher than a certain threshold in the stem graph: Score: 0.8 0.78 0.76 0.74 0.72 0.7 0.68 0.66 0.64 0.62 0.6 0.58 0.56 0.54 0.52 0.5 0.48 0.46 0.44 0.42 0.4 0.38 0.36 0.34 0.32 0.3 Num of edges: 18 21 25 28 31 44 57 67 74 90 104 121 144 162 194 219 249 274 305 332 351 379 410 444 469 507 538 Time spent on comparing stems: 0.14 seconds user CPU time; 0.16 seconds real time. =========================== S = 0.38 =========================== Find conserved stems (cliques) ... ==== 88 cliques ==== 8 unique ==== Time spent on finding conserved stems: 3.76 sec CPU time; 3.8 sec clock time. Construct clique topological graph ... ==== 1 edges ==== Assemble conserved stems (cliques) ... ==== 8 structures ==== Time spent on topologically assembling conserved stems: 0 sec CPU time; 0 sec clock time. Report top 10 structures. ------------------------------------------- Structure #1: Score = 15.8, pattern: 1, path: 3 0 , comseq: 4 6 8 9 11 13 14 15 18 , incompatible_seq: 3(12,16) 0() (a) Clique 3: OriginalScore = 6.48, ModifiedScore = 5.4 4, PKB186 2 AGCCU 6 AUUUGUAC 15 GGGUU 19 [-7.4 kc/m] 5, PKB187 2 CCGC 5 UGGGAUU 13 GCGG 16 [-8.3 kc/m] 6, PKB188 1 UCGU 4 UGCCGUC 12 ACGA 15 [-6.4 kc/m] 8, PKB194 2 ACGC 5 UGUACAGU 14 GCGU 17 [-7.5 kc/m] 9, PKB195 2 UCUGUU 7 GAUCA 13 AACAGA 18 [-8.8 kc/m] 11, PKB197 2 AACCU 6 AUUUGCUC 15 GGGUU 19 [-7.8 kc/m] *12, PKB198 1 ACCGC 5 CUGAUUA 13 GCGGU 17 [-10.4 kc/m] 13, PKB199 1 UCGUG 5 GUCAG 11 UACGA 15 [-7.2 kc/m] 14, PKB200 1 AGUCU 5 AAUUUGUC 14 GGGCU 18 [-7.1 kc/m] 15, PKB201 1 GGCGU 5 UCUACAGU 14 ACGUU 18 [-6.6 kc/m] *16, PKB202 2 GGUG 5 CUUGUUAUUU 16 CACC 19 [-6.8 kc/m] 18, PKB204 2 AGAGU 6 UAUCAU 13 ACUCU 17 [-7.8 kc/m] (b) Clique 0: OriginalScore = 10.4, ModifiedScore = 10.4 2, PKB184 7 UUUUCGA 13 ... 25 UCGAAGA 31 [-9.1 kc/m] 3, PKB185 5 GGCCAUC 11 ACGAUA 18 GAUGGUU 24 [-10.4 kc/m] 4, PKB186 8 UUUGUAC 14 GGGUUGA 22 GUACAAA 28 [-8.9 kc/m] 6, PKB188 7 CCGUC 11 ACGAUA 18 GACGG 22 [-9.3 kc/m] 7, PKB189 7 ACAUGUC 13 GGGCUGA 21 GACAUGU 27 [-11 kc/m] 8, PKB194 6 UGUACAGU 13 GCGUUAA 21 ACUGUACA 28 [-12.7 kc/m] 9, PKB195 7 UGAUCAA 13 ... 25 UUGAUUA 31 [-7.8 kc/m] 10, PKB196 5 GGUCAUU 11 GCGAUA 18 AAUGACU 24 [-9.9 kc/m] 11, PKB197 8 UUUGC 12 ... 24 GCAAA 28 [-7 kc/m] 12, PKB198 7 UGAUUAGC 14 GGUCUACAA 24 GUUAAUCG 31 [-9 kc/m] 13, PKB199 6 GUCAGU 11 ACGAUA 18 ACUGAU 23 [-8.9 kc/m] 14, PKB200 7 AUUUGUC 13 GGGCUGA 21 GACAAAU 27 [-8.9 kc/m] 15, PKB201 6 UCUACAGU 13 ACGUUUAA 22 ACUGUAGG 29 [-11.9 kc/m] 16, PKB202 8 UGUUAUUUC 16 ACCUAAAUC 26 GAAAUAACG 34 [-10.3 kc/m] 17, PKB203 6 GUCUUC 11 ACGAUA 18 GAAGAU 23 [-8.2 kc/m] 18, PKB204 9 UCAUA 13 CUCUAUAAAC 24 UAUGA 28 [-6.1 kc/m] PKB183 1 ACGUCGUGCAGUACGGUAAACUGCACA 27 aaaaabbbbbaaaaa bbbbb PKB184 1 UUCUGUUUUUCGAACAGAUGUAAAUCGAAGA 31 aaaaabbbbbbbaaaaa bbbbbbb PKB185 1 ACGUGGCCAUCACGAUAGAUGGUU 24 aaabbbbbbbaaa bbbbbbb PKB186 1 AAGCCUAUUUGUACGGGUUGAGUACAAAC 29 aaaaa bbbbbbbaaaaa bbbbbbb PKB187 1 GCCGCUGGGAUUGCGGAUUAUAAAUCG 27 aaaa bbbbaaaa bbbb PKB188 1 UCGUUGCCGUCACGAUAGACGGA 23 aaaa bbbbbaaaa bbbbb PKB189 1 AGUCUAACAUGUCGGGCUGAGACAUGUC 28 aaaaa bbbbbbbaaaaa bbbbbbb PKB194 1 UACGCUGUACAGUGCGUUAAACUGUACA 28 aaaabbbbbbbbaaaa bbbbbbbb PKB195 1 CUCUGUUGAUCAAACAGAAAUAAAUUGAUUA 31 aaaaaabbbbbaaaaaa bbbbb PKB196 1 ACGCGGUCAUUGCGAUAAAUGACU 24 aaabbbbbbbaaa bbbbbbb PKB197 1 GAACCUAUUUGCUCGGGUUGAGUGCAAAC 29 aaaaa bbbbb baaaaa b bbbbb PKB198 1 ACCGCCUGAUUAGCGGUCUACAAGUUAAUCGA 32 aaabbbbbbbbaaa bbbbbbbb PKB199 1 UCGUGGUCAGUACGAUAACUGAU 23 aaaaabbbbbaaaaa bbbbb PKB200 1 AGUCUAAUUUGUCGGGCUGAGACAAAUC 28 aaaaa bbbbbbbaaaaa bbbbbbb PKB201 1 GGCGUUCUACAGUACGUUUAAACUGUAGG 29 aaaaabbbbbbbbaaaaa bbbbbbbb PKB202 1 UGGUGCUUGUUAUUUCACCUAAAUCGAAAUAACG 34 aaa bbbbbbbbbaaa bbbbbbbbb PKB203 1 ACGUGGUCUUCACGAUAGAAGAUG 24 aaa bbbbbbaaa bbbbbb PKB204 1 CAGAGUUAUCAUACUCUAUAAACUAUGAC 29 aaaaa bbbbaaaaa bbbb Total time spent with S = 0.38: 3.91 seconds CPU time; 4.19 seconds real time. ************************************** Total Time spent: 3.91 seconds CPU time; 4.19 seconds real time. ../pubstruc_smv.bp smv_18seq.72out_P0.5_S0.38 Structure 1: TP= 160, FP= 33, FN= 13, CC= 0.88 1 structures, First #1: CC= 0.88, Best #1: CC= 0.88, Average: CC= 0.88